FANCM

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr14
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting FANCM.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
45605217
ATTAGGCCGACAACCACCGA
95.6
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 10
39.00
45645452
TGCTATTAGTGAAACGCCTC
77.3
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 2
3 Mismatches: 57
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
45605217
SEQUENCE
ATTAGGCCGACAACCACCGA
SCORE
95.6
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 10
PRICE
39.00
POSITION
45645452
SEQUENCE
TGCTATTAGTGAAACGCCTC
SCORE
77.3
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 2
3 Mismatches: 57
PRICE
39.00