HNF1A

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr12
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

The protein encoded by this gene is a transcription factor required for the expression of several liver-specific genes. The encoded protein functions as a homodimer and binds to the inverted palindrome 5'-GTTAATNATTAAC-3'. Defects in this gene are a cause of maturity onset diabetes of the young type 3 (MODY3) and also can result in the appearance of hepatic adenomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting HNF1A.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
121416714
AGTCCTGCGGCGGCGGTCGA
94.6
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 12
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
121416714
SEQUENCE
AGTCCTGCGGCGGCGGTCGA
SCORE
94.6
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 12
PRICE
39.00